Differential expression of a protease gene family in African trypanosomes.

Publisher: Elsevier/North-Holland Biomedical Press Country of Publication: Netherlands NLM ID: 8006324 Publication Model: Print-Electronic Cited Medium: Print ISSN: 0166-6851 (Print) Linking ISSN: 01666851 NLM ISO Abbreviation: Mol Biochem Parasitol Subsets: MEDLINE

Original Publication: Amsterdam, Elsevier/North-Holland Biomedical Press.

Gene Expression* ; Multigene Family*; Peptide Hydrolases/*genetics ; Protozoan Proteins/*genetics ; Trypanosoma brucei brucei/*genetics; 3' Untranslated Regions ; Animals ; Base Sequence ; Cell Line ; Genes, Reporter ; Humans ; Molecular Sequence Data ; Peptide Hydrolases/chemistry ; Peptide Hydrolases/metabolism ; Protozoan Proteins/chemistry ; Protozoan Proteins/metabolism ; RNA, Protozoan/chemistry ; RNA, Protozoan/genetics ; Sequence Alignment ; Transcription, Genetic ; Trypanosoma brucei brucei/chemistry ; Trypanosoma brucei brucei/enzymology ; Trypanosomiasis, African/parasitology

During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3'-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3'-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3'-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3'-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation.

J Mol Biol. 1988 May 20;201(2):315-25. (PMID: 2458474)
J Biol Chem. 2000 Apr 7;275(14):10218-27. (PMID: 10744707)
Gene. 1989 Apr 15;77(1):51-9. (PMID: 2744487)
Gene. 1989 Apr 15;77(1):61-8. (PMID: 2744488)
RNA. 1999 Dec;5(12):1632-44. (PMID: 10606273)
Mol Biochem Parasitol. 2008 Jun;159(2):134-7. (PMID: 18384893)
Curr Opin Genet Dev. 2000 Apr;10(2):193-8. (PMID: 10753781)
J Biol Chem. 2000 Apr 21;275(16):12051-60. (PMID: 10766837)
Mol Biochem Parasitol. 2001 Jan 15;112(1):51-9. (PMID: 11166386)
Nucleic Acids Res. 2001 May 15;29(10):2012-9. (PMID: 11353069)
J Biol Chem. 2001 Sep 14;276(37):34801-9. (PMID: 11435421)
Nucleic Acids Res. 2001 Nov 15;29(22):4707-15. (PMID: 11713321)
EMBO J. 2002 Apr 15;21(8):1881-8. (PMID: 11953307)
J Biol Chem. 2002 May 17;277(20):17580-8. (PMID: 11877446)
Mol Biochem Parasitol. 2002 Jun;122(1):81-9. (PMID: 12076772)
Nucleic Acids Res. 2002 Oct 15;30(20):4414-24. (PMID: 12384588)
J Biol Chem. 2002 Dec 27;277(52):50520-8. (PMID: 12403777)
J Biol Chem. 2003 Jul 4;278(27):24658-64. (PMID: 12707278)
Nature. 2004 Sep 16;431(7006):350-5. (PMID: 15372042)
Biochemistry. 1977 Jan 11;16(1):85-91. (PMID: 12797)
Parasitology. 1980 Apr;80(2):371-82. (PMID: 6154276)
Proc Natl Acad Sci U S A. 1985 Dec;82(23):7870-3. (PMID: 3906652)
Nucleic Acids Res. 1991 May 25;19(10):2707-14. (PMID: 1710343)
J Neurobiol. 1991 Jul;22(5):443-61. (PMID: 1716300)
Cell. 1993 Jan 15;72(1):19-28. (PMID: 8380757)
Gene. 1995 Aug 30;162(1):153-6. (PMID: 7557405)
Trends Biochem Sci. 1995 Nov;20(11):465-70. (PMID: 8578590)
Nucleic Acids Res. 1996 Apr 1;24(7):1202-11. (PMID: 8614620)
Biochemistry. 1996 Oct 22;35(42):13586-96. (PMID: 8885838)
Nucleic Acids Res. 1997 Aug 1;25(15):3017-26. (PMID: 9224601)
Mol Cell Biol. 1997 Aug;17(8):4372-80. (PMID: 9234695)
J Biol Chem. 1997 Oct 17;272(42):26742-8. (PMID: 9334260)
EMBO J. 1998 Jun 15;17(12):3448-60. (PMID: 9628880)
EMBO J. 1998 Jun 15;17(12):3461-70. (PMID: 9628881)
Proc Natl Acad Sci U S A. 1999 Jan 5;96(1):5-7. (PMID: 9874760)
Mol Biochem Parasitol. 1998 Nov 30;97(1-2):189-98. (PMID: 9879897)
J Interferon Cytokine Res. 2005 Jan;25(1):1-10. (PMID: 15684617)
Nucleic Acids Res. 2005 Jul 1;33(Web Server issue):W577-81. (PMID: 15980540)
Mol Biochem Parasitol. 2005 Oct;143(2):125-34. (PMID: 15993496)
Science. 2005 Sep 2;309(5740):1519-24. (PMID: 16141061)
Microbes Infect. 2006 Mar;8(3):930-7. (PMID: 16480910)
Exp Parasitol. 2006 Jun;113(2):112-24. (PMID: 16460732)
Mol Biochem Parasitol. 2006 Dec;150(2):340-9. (PMID: 17052765)
Science. 2007 Apr 20;316(5823):407-8. (PMID: 17446393)
Mol Cell Biol. 2007 Aug;27(15):5365-80. (PMID: 17548472)
Mol Microbiol. 2007 Aug;65(3):655-70. (PMID: 17635187)
Mol Biochem Parasitol. 2007 Dec;156(2):93-101. (PMID: 17765983)
PLoS Pathog. 2007 Oct 19;3(10):1432-45. (PMID: 17953481)
Science. 1988 Dec 16;242(4885):1570-2. (PMID: 3144044)

T32 007511 United States PHS HHS; R01 AI059451-03 United States AI NIAID NIH HHS; T32 AI007511 United States AI NIAID NIH HHS; R01 AI059451 United States AI NIAID NIH HHS; T32 AI007511-12 United States AI NIAID NIH HHS

0 (3' Untranslated Regions)
0 (Protozoan Proteins)
0 (RNA, Protozoan)
EC 3.4.- (Peptide Hydrolases)

Date Created: 20081014 Date Completed: 20090205 Latest Revision: 20190508

20250114

PMC2633602

10.1016/j.molbiopara.2008.09.004

18848586